MolNFT v1 · #114566 · protein + DNA

Crystal structure of a topoisomerase II complex

5BTI · DNA gyrase subunit a: “Crystal structure of a topoisomerase II complex”. X-ray diffraction, 2 ligands (LFX, MG), 13 pockets (best druggability 0.86). MolNFT v1 #114566 on GenesisL1: 3D structure, binding sites and pockets in GL1X.

PDB: 5BTI
Type: protein + DNA
Length: 1,546 residues
Chains: 8
Method: x-ray diffraction
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: DNA gyrase subunit a; DNA gyrase subunit B; DNA substrate 24-mer…
EC: 5.99.1.3
UniProt: P9WG47, P9WG45
Ligands: LFX, MG
Pockets: 13 · best druggability 0.86

Structure

x-ray diffraction · 5 distinct chains · 47% helix, 17% strand (DSSP).

Chain	Molecule	Type	Residues	Secondary structure	UniProt
A, C	DNA gyrase subunit a (EC 5.99.1.3)	protein	487	50% helix, 18% strand	P9WG47
B	DNA gyrase subunit B (EC 5.99.1.3)	protein	245	44% helix, 16% strand	P9WG45
D	DNA gyrase subunit B (EC 5.99.1.3)	protein	247	43% helix, 15% strand	P9WG45
E, H	DNA substrate 24-mer ggtcatgaatgactatgcacgtaa	dna	20	—	—
F, G	DNA substrate 24-mer ttacgtgcatagtcattcatgacc	dna	20	—	—

Ligands and binding sites

LFX · (3S)-9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid · ligand · 2 copies · chains A, B, C, E, F, G, H, D
MG · Magnesium ion · metal · 4 copies · chains B, E, G, C, F, H, D, A

Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.

Pockets

13 pockets found on a 1 Å grid, 12 with a druggability of 0.5 or more.

Pocket	Volume (Å³)	Druggability	Buriedness	Lining residues	Inside
1	1078	0.86	0.87	136	MG, LFX
2	354	0.79	0.90	54	empty
3	1110	0.76	0.78	97	empty
4	477	0.75	0.84	54	empty
5	575	0.74	0.82	64	empty

Interfaces

27 interfaces between chains.

F–H · 2433 Å² buried · 783 hydrogen bonds · nucleic-nucleic
E–G · 2427 Å² buried · 768 hydrogen bonds · nucleic-nucleic
A–C · 1858 Å² buried · 21 hydrogen bonds · protein-protein
A–B · 1612 Å² buried · 16 hydrogen bonds · protein-protein
C–D · 1610 Å² buried · 18 hydrogen bonds · protein-protein

Modifications

Observed in the structure: 2 modified (phosphorylation).

Compared structures

5BTI · Crystal structure of a topoisomerase II complex · the same entry in another collection · chain H against H, TM-score 1.00
P9WG47 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit a (P9WG47) · a predicted model of the same protein · chain A against A, TM-score 0.98
P9WG45 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit B (P9WG45) · a predicted model of the same protein · chain B against A, TM-score 0.91

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Every structure of UniProt P9WG47
Every structure of UniProt P9WG45
Elsewhere: RCSB PDB 5BTI · PDBe 5BTI · UniProt P9WG47 · UniProt P9WG45

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.