MolNFT v1 · #114560 · protein + DNA
Crystal structure of a topoisomerase II complex
5BTC · DNA gyrase subunit a: “Crystal structure of a topoisomerase II complex”. X-ray diffraction, 2 ligands (CPF, MG), 17 pockets (best druggability 0.85). MolNFT v1 #114560 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 5BTC
- Type
- protein + DNA
- Length
- 1,546 residues
- Chains
- 8
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA gyrase subunit a; DNA gyrase subunit B; DNA substrate 24-mer…
- EC
- 5.99.1.3
- UniProt
- P9WG47, P9WG45
- Ligands
- CPF, MG
- Pockets
- 17 · best druggability 0.85
Structure
x-ray diffraction · 5 distinct chains · 47% helix, 17% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A, C | DNA gyrase subunit a (EC 5.99.1.3) | protein | 487 | 50% helix, 18% strand | P9WG47 |
| B | DNA gyrase subunit B (EC 5.99.1.3) | protein | 245 | 44% helix, 16% strand | P9WG45 |
| D | DNA gyrase subunit B (EC 5.99.1.3) | protein | 247 | 43% helix, 15% strand | P9WG45 |
| E, H | DNA substrate 24-mer ggtcatgaatgactatgcacgtaa | dna | 20 | — | — |
| F, G | DNA substrate 24-mer ttacgtgcatagtcattcatgacc | dna | 20 | — | — |
Ligands and binding sites
- CPF · 1-cyclopropyl-6-fluoro-4-oxo-7-piperazin-1-yl-1,4-dihydroquinoline-3-carboxylic acid · ligand · 2 copies · chains A, C, D, E, F, G, H, B
- MG · Magnesium ion · metal · 4 copies · chains A, E, G, B, C, F, H, D
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Pockets
17 pockets found on a 1 Å grid, 15 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 977 | 0.85 | 0.87 | 123 | MG, CPF |
| 2 | 295 | 0.76 | 0.88 | 43 | empty |
| 3 | 538 | 0.74 | 0.82 | 60 | empty |
| 4 | 454 | 0.73 | 0.83 | 48 | empty |
| 5 | 448 | 0.72 | 0.82 | 45 | empty |
Interfaces
27 interfaces between chains.
- F–H · 2436 Ų buried · 783 hydrogen bonds · nucleic-nucleic
- E–G · 2433 Ų buried · 784 hydrogen bonds · nucleic-nucleic
- A–C · 1785 Ų buried · 21 hydrogen bonds · protein-protein
- C–D · 1606 Ų buried · 16 hydrogen bonds · protein-protein
- A–B · 1606 Ų buried · 18 hydrogen bonds · protein-protein
Modifications
Observed in the structure: 2 modified (phosphorylation).
Compared structures
- 5BTC · Crystal structure of a topoisomerase II complex · the same entry in another collection · chain H against H, TM-score 1.00
- P9WG47 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit a (P9WG47) · a predicted model of the same protein · chain A against A, TM-score 0.98
- P9WG45 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit B (P9WG45) · a predicted model of the same protein · chain B against A, TM-score 0.91
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P9WG47
- Every structure of UniProt P9WG45
- Elsewhere: RCSB PDB 5BTC · PDBe 5BTC · UniProt P9WG47 · UniProt P9WG45
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.