Research workbench

Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex, NMR, 7 structures

Analyse Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex… in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.

PDB: 1TOB
Type: RNA
Length: 27 nucleotides
Chains: 1
Method: solution nmr
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3')
Ligands: TOA, TOC, TOB
Pockets: 1 · best druggability 0.32

Structure

solution nmr · 1 distinct chain.

Chain	Molecule	Type	Residues	Secondary structure	UniProt
A	RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3')	rna	27	—	—

Ligands and binding sites

TOA · 3-ammonio-3-deoxy-alpha-D-glucopyranose · ligand · chains A
TOC · 2,6-diammonio-2,3,6-trideoxy-alpha-D-glucopyranose · ligand · chains A
TOB · 1,3-diamino-5,6-dihydroxycyclohexane · ligand · chains A

Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.

Pockets

1 pocket found on a 1 Å grid, 0 with a druggability of 0.5 or more.

Pocket	Volume (Å³)	Druggability	Buriedness	Lining residues	Inside
1	87	0.32	0.74	12	TOA, TOB

Compared structures

1TOB · Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex, NMR, 7… · the same entry in another collection · chain A against A, TM-score 1.00

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Elsewhere: RCSB PDB 1TOB · PDBe 1TOB

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.