Research workbench
Crystal structure of fis bound to 27BP DNA F35 (aaattagtttgaatctcgagctaattt)
Analyse Crystal structure of fis bound to 27BP DNA F35 (aaattagtttgaatctcgagctaattt) in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.
- PDB
- 5E3M
- Type
- protein + DNA
- Length
- 243 residues
- Chains
- 4
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA-binding protein fis; DNA (27-mer)
- UniProt
- P0A6R3
- Pockets
- 7 · best druggability 0.63
Structure
x-ray diffraction · 4 distinct chains · 57% helix, 11% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | DNA-binding protein fis | protein | 91 | 58% helix, 11% strand | P0A6R3 |
| B | DNA-binding protein fis | protein | 98 | 56% helix, 10% strand | P0A6R3 |
| C | DNA (27-mer) | dna | 27 | — | — |
| D | DNA (27-mer) | dna | 27 | — | — |
Pockets
7 pockets found on a 1 Å grid, 1 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 500 | 0.63 | 0.76 | 37 | empty |
| 2 | 213 | 0.47 | 0.74 | 25 | empty |
| 3 | 93 | 0.36 | 0.75 | 16 | empty |
| 4 | 114 | 0.36 | 0.74 | 17 | empty |
| 5 | 51 | 0.32 | 0.77 | 15 | empty |
Interfaces
6 interfaces between chains.
- A–B · 2322 Ų buried · 23 hydrogen bonds · protein-protein
- C–D · 1155 Ų buried · 104 hydrogen bonds · nucleic-nucleic
- B–C · 280 Ų buried · 11 hydrogen bonds · protein-nucleic
- A–D · 277 Ų buried · 10 hydrogen bonds · protein-nucleic
- B–D · 268 Ų buried · 6 hydrogen bonds · protein-nucleic
Compared structures
- 5E3M · Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) · the same entry in another collection · chain A against A, TM-score 1.00
- P0A6R3 · AlphaFold monomer V2.0 prediction for DNA-binding protein fis (P0A6R3) · a predicted model of the same protein · chain A against A, TM-score 0.93
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P0A6R3
- Elsewhere: RCSB PDB 5E3M · PDBe 5E3M · UniProt P0A6R3
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.