AlphaFold monomer V2.0 prediction for DNA-binding protein fis (P0A6R3)

Structure

1 distinct chain · 53% helix, 10% strand (DSSP).

Compared structures

• 3JR9 · Crystal structure of Fis bound to 27 bp optimal binding sequence F2 · an experimental structure of the same protein · chain A against B, TM-score 0.90
• 3JR9 · Crystal structure of fis bound to 27 bp optimal binding sequence F2 · an experimental structure of the same protein · chain A against B, TM-score 0.90
• 3JRD · Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at center · an experimental structure of the same protein · chain A against B, TM-score 0.90
• 3JRD · Crystal structure of fis bound to 27 bp DNA F25 containing T2A3 sequence at center · an experimental structure of the same protein · chain A against B, TM-score 0.90
• 5DS9 · Crystal structure of fis bound to 27BP DNA F1-8A (aaattagtttgaattttgagctaattt) · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 5DS9 · Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 5DTD · Crystal structure of fis bound to 27BP DNA F1-8C (aaattcgtttgaattttgagcgaattt) · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 5DTD · Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 3JRA · Crystal structure of fis bound to 27BP non consensus sequence DNA F6 · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 3JRA · Crystal structure of Fis bound to 27bp non consensus sequence DNA F6 · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 5E3O · Crystal structure of fis bound to 27BP DNA F32 (aaatttggaggaattttctccaaattt) · an experimental structure of the same protein · chain A against B, TM-score 0.89
• 5E3O · Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) · an experimental structure of the same protein · chain A against B, TM-score 0.89

Analyse

• Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
• Every structure of UniProt P0A6R3
• Elsewhere: UniProt P0A6R3 · AlphaFold DB P0A6R3