UniProt P0A6R3
DNA-binding protein Fis (P0A6R3)
DNA-binding protein Fis (UniProt P0A6R3): 62 experimental structures and 1 predicted model on GenesisL1, 26 pockets. Binding sites, druggability and experiment against prediction (TM-score) in GL1X.
- UniProt
- P0A6R3
- Protein
- DNA-binding protein Fis
- Experimental structures
- 62
- Predicted models
- 1
- Pockets
- 26 · 6 records with a druggable one
Structures
63 records of P0A6R3 in the MolNFT archive: 62 experimental, 1 predicted.
| Entry | Title | Method | Chains | Ligands | Pockets |
|---|---|---|---|---|---|
| 1ETK | The crystal structure of E. COLI fis mutant Q68A | x-ray diffraction | A, B | — | — |
| 1ETK | The crystal structure of E. COLI fis mutant Q68A | x-ray diffraction | A, B | — | — |
| 1ETO | The crystal structure of E. COLI fis mutant R71L | x-ray diffraction | A, B | — | — |
| 1ETO | The crystal structure of E. COLI fis mutant R71L | x-ray diffraction | A, B | — | — |
| 1ETQ | The crystal structure of E. COLI fis mutant R71Y | x-ray diffraction | A, B, C, D | — | — |
| 1ETQ | The crystal structure of E. COLI fis mutant R71Y | x-ray diffraction | A, B, C, D | — | — |
| 1ETV | The crystal structure of E. COLI fis mutant G72A | x-ray diffraction | A, B | — | — |
| 1ETV | The crystal structure of E. COLI fis mutant G72A | x-ray diffraction | A, B | — | — |
| 1ETW | The crystal structure of E. COLI fis mutant G72D | x-ray diffraction | A, B | — | — |
| 1ETW | The crystal structure of E. COLI fis mutant G72D | x-ray diffraction | A, B | — | — |
| 1ETX | The crystal structure of E. COLI fis mutant Q74A | x-ray diffraction | A, B | — | — |
| 1ETX | The crystal structure of E. COLI fis mutant Q74A | x-ray diffraction | A, B | — | — |
| 1ETY | The crystal structure of E. COLI wild-type fis | x-ray diffraction | A, B | — | — |
| 1ETY | The crystal structure of E. COLI wild-type fis | x-ray diffraction | A, B | — | — |
| 1F36 | The crystal structure of fis mutant K36E reveals that the transactivation region of the fis protein… | x-ray diffraction | A, B | — | — |
| 1F36 | The crystal structure of fis mutant K36E reveals that the transactivation region of the fis protein… | x-ray diffraction | A, B | — | — |
| 1FIA | Crystal structure of the factor for inversion stimulation fis at 2.0 ångströms resolution | x-ray diffraction | A, B | — | — |
| 1FIA | Crystal structure of the factor for inversion stimulation fis at 2.0 ångströms resolution | x-ray diffraction | A, B | — | — |
| 3FIS | The molecular structure of wild-type and a mutant fis protein: relationship between mutational… | x-ray diffraction | A, B | — | — |
| 3FIS | The molecular structure of wild-type and a mutant fis protein: relationship between mutational… | x-ray diffraction | A, B | — | — |
| 3IV5 | Crystal structure of Fis bound to 27 bp optimal binding sequence F1 | x-ray diffraction | A, B | — | — |
| 3IV5 | Crystal structure of fis bound to 27 bp optimal binding sequence F1 | x-ray diffraction | A, B | — | — |
| 3JR9 | Crystal structure of Fis bound to 27 bp optimal binding sequence F2 | x-ray diffraction | A, B | — | — |
| 3JR9 | Crystal structure of fis bound to 27 bp optimal binding sequence F2 | x-ray diffraction | A, B | — | — |
| 3JRA | Crystal structure of Fis bound to 27bp non consensus sequence DNA F6 | x-ray diffraction | A, B | — | — |
| 3JRA | Crystal structure of fis bound to 27BP non consensus sequence DNA F6 | x-ray diffraction | A, B | — | — |
| 3JRB | Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at center | x-ray diffraction | A, B | — | — |
| 3JRB | Crystal structure of fis bound to 27 bp DNA F24 containing T-tract at center | x-ray diffraction | A, B | — | — |
| 3JRC | Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at center | x-ray diffraction | A, B | — | — |
| 3JRC | Crystal structure of fis bound to 27 bp DNA F29 containing 5 G/CS at center | x-ray diffraction | A, B | — | — |
| 3JRD | Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at center | x-ray diffraction | A, B | — | — |
| 3JRD | Crystal structure of fis bound to 27 bp DNA F25 containing T2A3 sequence at center | x-ray diffraction | A, B | — | — |
| 3JRE | Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at center | x-ray diffraction | A, B | — | — |
| 3JRE | Crystal structure of fis bound to 27 bp DNA F26 containing a-tract at center | x-ray diffraction | A, B | — | — |
| 3JRF | Crystal structure of Fis bound to 27 bp DNA F27 containing a C/G at center | x-ray diffraction | A, B | — | — |
| 3JRF | Crystal structure of fis bound to 27 bp DNA F27 containing a C/G at center | x-ray diffraction | A, B | — | — |
| 3JRG | Crystal structure of Fis bound to 27 bp non consensus sequence DNA F18 | x-ray diffraction | A, B | — | — |
| 3JRG | Crystal structure of fis bound to 27 bp non consensus sequence DNA F18 | x-ray diffraction | A, B | — | — |
| 3JRH | Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21 | x-ray diffraction | A, B | — | — |
| 3JRH | Crystal structure of fis bound to 27 bp non consensus sequence DNA F21 | x-ray diffraction | A, B | — | — |
| 3JRI | Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23 | x-ray diffraction | A, B | — | — |
| 3JRI | Crystal structure of fis bound to 27 bp non consensus sequence DNA F23 | x-ray diffraction | A, B | — | — |
| 4FIS | The molecular structure of wild-type and a mutant fis protein: relationship between mutational… | x-ray diffraction | A, B | — | — |
| 4FIS | The molecular structure of wild-type and a mutant fis protein: relationship between mutational… | x-ray diffraction | A, B | — | — |
| 5DS9 | Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) | x-ray diffraction | A, B | — | — |
| 5DS9 | Crystal structure of fis bound to 27BP DNA F1-8A (aaattagtttgaattttgagctaattt) | x-ray diffraction | A, B | — | — |
| 5DTD | Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) | x-ray diffraction | A, B | — | 4 (best 0.63) |
| 5DTD | Crystal structure of fis bound to 27BP DNA F1-8C (aaattcgtttgaattttgagcgaattt) | x-ray diffraction | A, B | — | — |
| 5E3L | Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) | x-ray diffraction | A, B | — | 4 (best 0.63) |
| 5E3L | Crystal structure of fis bound to 27BP DNA F1-8G (aaattggtttgaattttgagccaattt) | x-ray diffraction | A, B | — | — |
| 5E3M | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | x-ray diffraction | A, B | — | — |
| 5E3M | Crystal structure of fis bound to 27BP DNA F35 (aaattagtttgaatctcgagctaattt) | x-ray diffraction | A, B | — | — |
| 5E3N | Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT) | x-ray diffraction | A, B | — | — |
| 5E3N | Crystal structure of fis bound to 27BP DNA F31 (aaatttgtaggaattttctgcaaattt) | x-ray diffraction | A, B | — | — |
| 5E3O | Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) | x-ray diffraction | A, B | — | 4 (best 0.63) |
| 5E3O | Crystal structure of fis bound to 27BP DNA F32 (aaatttggaggaattttctccaaattt) | x-ray diffraction | A, B | — | — |
| 6P0S | Crystal structure of ternary DNA complex FX2" containing E. coli Fis and phage lambda Xis" | x-ray diffraction | A, B | — | 5 (best 0.62) |
| 6P0S | Crystal structure of ternary DNA complex "FX2" containing E. COLI fis and phage lambda xis | x-ray diffraction | A, B | — | — |
| 6P0T | Crystal structure of ternary DNA complex FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis" | x-ray diffraction | B, A | — | 6 (best 0.61) |
| 6P0T | Crystal structure of ternary DNA complex "FX(1-2)-1XIS" containing E. COLI fis and phage lambda xis | x-ray diffraction | B, A | — | — |
3 records more on the page itself.
Experiment against prediction
- 4FIS chain B against the predicted model P0A6R3: TM-score 0.98, RMSD 0.47 Å
- 4FIS chain B against the predicted model P0A6R3: TM-score 0.98, RMSD 0.47 Å
- 3FIS chain B against the predicted model P0A6R3: TM-score 0.98, RMSD 0.50 Å
- 3FIS chain B against the predicted model P0A6R3: TM-score 0.98, RMSD 0.50 Å
- 1ETQ chain D against the predicted model P0A6R3: TM-score 0.97, RMSD 0.59 Å
- 1ETQ chain D against the predicted model P0A6R3: TM-score 0.97, RMSD 0.59 Å
- 1FIA chain B against the predicted model P0A6R3: TM-score 0.97, RMSD 0.64 Å
- 1FIA chain B against the predicted model P0A6R3: TM-score 0.97, RMSD 0.64 Å
- 1ETQ chain C against the predicted model P0A6R3: TM-score 0.96, RMSD 0.66 Å
- 1ETQ chain C against the predicted model P0A6R3: TM-score 0.96, RMSD 0.66 Å
Elsewhere
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.