MolNFT v1 · #117291 · protein + DNA
Crystal structure of fis bound to 27BP DNA F31 (aaatttgtaggaattttctgcaaattt)
5E3N · DNA-binding protein fis: “Crystal structure of fis bound to 27BP DNA F31 (aaatttgtaggaattttctgcaaattt)”. X-ray diffraction, 4 pockets (best druggability 0.63). MolNFT v1 #117291 on GenesisL1: 3D structure, binding sites and pockets…
- PDB
- 5E3N
- Type
- protein + DNA
- Length
- 243 residues
- Chains
- 4
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA-binding protein fis; DNA (27-mer)
- UniProt
- P0A6R3
- Pockets
- 4 · best druggability 0.63
Structure
x-ray diffraction · 4 distinct chains · 57% helix, 11% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | DNA-binding protein fis | protein | 91 | 58% helix, 11% strand | P0A6R3 |
| B | DNA-binding protein fis | protein | 98 | 56% helix, 10% strand | P0A6R3 |
| C | DNA (27-mer) | dna | 27 | — | — |
| D | DNA (27-mer) | dna | 27 | — | — |
Pockets
4 pockets found on a 1 Å grid, 1 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 460 | 0.63 | 0.77 | 36 | empty |
| 2 | 165 | 0.44 | 0.75 | 30 | empty |
| 3 | 108 | 0.37 | 0.75 | 17 | empty |
| 4 | 55 | 0.33 | 0.77 | 15 | empty |
Interfaces
6 interfaces between chains.
- A–B · 2237 Ų buried · 25 hydrogen bonds · protein-protein
- C–D · 1217 Ų buried · 130 hydrogen bonds · nucleic-nucleic
- B–C · 296 Ų buried · 12 hydrogen bonds · protein-nucleic
- A–D · 292 Ų buried · 11 hydrogen bonds · protein-nucleic
- A–C · 270 Ų buried · 3 hydrogen bonds · protein-nucleic
Compared structures
- 5E3N · Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT) · the same entry in another collection · chain A against A, TM-score 1.00
- P0A6R3 · AlphaFold monomer V2.0 prediction for DNA-binding protein fis (P0A6R3) · a predicted model of the same protein · chain A against A, TM-score 0.93
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P0A6R3
- Elsewhere: RCSB PDB 5E3N · PDBe 5E3N · UniProt P0A6R3
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.