Research workbench
Crystal structure of fis bound to 27BP DNA F1-8G (aaattggtttgaattttgagccaattt)
Analyse Crystal structure of fis bound to 27BP DNA F1-8G (aaattggtttgaattttgagccaattt) in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.
- PDB
- 5E3L
- Type
- protein + DNA
- Length
- 243 residues
- Chains
- 4
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA-binding protein fis; DNA (27-mer)
- UniProt
- P0A6R3
- Pockets
- 4 · best druggability 0.63
Structure
x-ray diffraction · 4 distinct chains · 57% helix, 11% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | DNA-binding protein fis | protein | 91 | 58% helix, 11% strand | P0A6R3 |
| B | DNA-binding protein fis | protein | 98 | 56% helix, 10% strand | P0A6R3 |
| C | DNA (27-mer) | dna | 27 | — | — |
| D | DNA (27-mer) | dna | 27 | — | — |
Pockets
4 pockets found on a 1 Å grid, 1 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 491 | 0.63 | 0.76 | 38 | empty |
| 2 | 232 | 0.49 | 0.75 | 29 | empty |
| 3 | 207 | 0.48 | 0.75 | 27 | empty |
| 4 | 57 | 0.32 | 0.77 | 13 | empty |
Interfaces
6 interfaces between chains.
- A–B · 2323 Ų buried · 20 hydrogen bonds · protein-protein
- C–D · 1176 Ų buried · 122 hydrogen bonds · nucleic-nucleic
- B–C · 288 Ų buried · 10 hydrogen bonds · protein-nucleic
- A–D · 277 Ų buried · 11 hydrogen bonds · protein-nucleic
- A–C · 265 Ų buried · 5 hydrogen bonds · protein-nucleic
Compared structures
- 5E3L · Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) · the same entry in another collection · chain A against A, TM-score 1.00
- P0A6R3 · AlphaFold monomer V2.0 prediction for DNA-binding protein fis (P0A6R3) · a predicted model of the same protein · chain A against A, TM-score 0.93
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P0A6R3
- Elsewhere: RCSB PDB 5E3L · PDBe 5E3L · UniProt P0A6R3
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.