Research workbench
Crystal structure of fis bound to 27 bp sequence DNA F28 (aaatttgtttgagcgttgagcaaattt)
Analyse Crystal structure of fis bound to 27 bp sequence DNA F28… in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.
- PDB
- 4IHV
- Type
- protein + DNA
- Length
- 243 residues
- Chains
- 4
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- UniProt
- C9QXL3
Structure
x-ray diffraction · 4 distinct chains.
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | — | protein | 91 | — | C9QXL3 |
| B | — | protein | 98 | — | C9QXL3 |
| C | — | dna | 27 | — | — |
| D | — | dna | 27 | — | — |
Compared structures
- 4IHV · Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) · the same entry in another collection · chain A against A, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt C9QXL3
- Elsewhere: RCSB PDB 4IHV · PDBe 4IHV · UniProt C9QXL3
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.