UniProt C9QXL3
C9QXL3
C9QXL3 (UniProt C9QXL3): 8 experimental structures on GenesisL1. Binding sites, pockets, druggability and 3D structures in GL1X.
- UniProt
- C9QXL3
- Experimental structures
- 8
- Predicted models
- 0
Structures
8 records of C9QXL3 in the MolNFT archive: 8 experimental, 0 predicted.
| Entry | Title | Method | Chains | Ligands | Pockets |
|---|---|---|---|---|---|
| 4IHV | Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) | x-ray diffraction | A, B | — | — |
| 4IHV | Crystal structure of fis bound to 27 bp sequence DNA F28 (aaatttgtttgagcgttgagcaaattt) | x-ray diffraction | A, B | — | — |
| 4IHW | Crystal structure of Fis bound to 27 bp Inosine substituted DNA F28-dI (AAATTTGTTTGAICITTGAGCAAATTT) | x-ray diffraction | A, B | — | — |
| 4IHW | Crystal structure of fis bound to 27 bp inosine substituted DNA F28-di (aaatttgtttgaicittgagcaaattt) | x-ray diffraction | A, B | — | — |
| 4IHX | Crystal structure of Fis bound to 27 bp 2-Aminopurine substituted DNA F28-2AP… | x-ray diffraction | A, B | — | — |
| 4IHX | Crystal structure of fis bound to 27 bp 2-aminopurine substituted DNA F28-2AP… | x-ray diffraction | A, B | — | — |
| 4IHY | Crystal structure of Fis bound to 27bp Inosine substituted DNA F29-dI (AAATTTGTTTGIICICTGAGCAAATTT) | x-ray diffraction | A, B | — | — |
| 4IHY | Crystal structure of fis bound to 27BP inosine substituted DNA F29-di (aaatttgtttgiicictgagcaaattt) | x-ray diffraction | A, B | — | — |
Elsewhere
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.