Research workbench
Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrttr guide RNA complex
Analyse Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrttr guide… in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.
- PDB
- 5T7B
- Type
- protein + RNA
- Length
- 813 residues
- Chains
- 2
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- RNA (UVP)UAUAGAGCAAGAACACUGUU; Protein argonaute-2
- EC
- 3.1.26.-
- UniProt
- Q9UKV8
- Ligands
- IPH
- Pockets
- 10 · best druggability 0.83
Structure
x-ray diffraction · 2 distinct chains · 31% helix, 29% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| R | RNA (UVP)UAUAGAGCAAGAACACUGUU | rna | 11 | — | — |
| A | Protein argonaute-2 (EC 3.1.26.-) | protein | 802 | 31% helix, 29% strand | Q9UKV8 |
Ligands and binding sites
- IPH · Phenol · ligand · 2 copies · chains A
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Pockets
10 pockets found on a 1 Å grid, 1 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 972 | 0.83 | 0.85 | 85 | empty |
| 2 | 119 | 0.49 | 0.80 | 21 | empty |
| 3 | 137 | 0.48 | 0.78 | 24 | empty |
| 4 | 99 | 0.45 | 0.79 | 17 | empty |
| 5 | 161 | 0.43 | 0.74 | 18 | empty |
Interfaces
1 interface between chains.
- R–A · 1890 Ų buried · 53 hydrogen bonds · protein-nucleic
Modifications
Observed in the structure: 1 modified (nucleotide modification).
Compared structures
- 5T7B · Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex · the same entry in another collection · chain R against R, TM-score 1.00
- Q9UKV8 · AlphaFold monomer V2.0 prediction for protein argonaute-2 (Q9UKV8) · a predicted model of the same protein · chain A against A, TM-score 0.97
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt Q9UKV8
- Elsewhere: RCSB PDB 5T7B · PDBe 5T7B · UniProt Q9UKV8
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.