Research workbench

X-ray structure of the nucleosome core particle, NCP146B, at 2.6 a resolution

Analyse X-ray structure of the nucleosome core particle, NCP146B, at 2.6 a resolution in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.

PDB: 1KX4
Type: protein + DNA
Length: 1,049 residues
Chains: 10
Method: x-ray diffraction
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAA…
UniProt: P16105, P02304, P06897, P02281
Ligands: MN, CL
Pockets: 20 · best druggability 0.77

Structure

x-ray diffraction · 9 distinct chains · 63% helix, 6% strand (DSSP).

Chain	Molecule	Type	Residues	Secondary structure	UniProt
I, J	DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAA agggaaacttcaactgaattcagttgaagtttccctttgatagcgcagtttgacacact TTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')	dna	146	—	—
A	Histone H3	protein	98	64% helix, 4% strand	P16105
B	Histone H4	protein	83	60% helix, 8% strand	P02304
C	Histone H2A.1	protein	103	58% helix, 6% strand	P06897
D	Histone H2B.2	protein	99	71% helix, 4% strand	P02281
E	Histone H3	protein	97	64% helix, 4% strand	P16105
F	Histone H4	protein	78	63% helix, 8% strand	P02304
G	Histone H2A.1	protein	105	55% helix, 7% strand	P06897
H	Histone H2B.2	protein	94	71% helix, 4% strand	P02281

Ligands and binding sites

MN · Manganese (II) ion · metal · 6 copies · chains I, J, A, B
CL · Chloride ion · ion · 4 copies · chains A, J, C, D, E, I, G, H

Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.

Pockets

20 pockets found on a 1 Å grid, 20 with a druggability of 0.5 or more.

Pocket	Volume (Å³)	Druggability	Buriedness	Lining residues	Inside
1	464	0.77	0.85	56	empty
2	267	0.74	0.88	39	empty
3	496	0.71	0.81	40	empty
4	770	0.69	0.76	64	empty
5	726	0.67	0.75	72	empty

Interfaces

35 interfaces between chains.

I–J · 6313 Å² buried · 432 hydrogen bonds · nucleic-nucleic
A–B · 2662 Å² buried · 27 hydrogen bonds · protein-protein
C–D · 2648 Å² buried · 27 hydrogen bonds · protein-protein
G–H · 2590 Å² buried · 26 hydrogen bonds · protein-protein
E–F · 2553 Å² buried · 25 hydrogen bonds · protein-protein

Compared structures

1KX4 · X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution · the same entry in another collection · chain H against H, TM-score 1.00
P06897 · AlphaFold monomer V2.0 prediction for histone H2A type 1 (P06897) · a predicted model of the same protein · chain C against A, TM-score 0.96

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Every structure of UniProt P16105
Every structure of UniProt P02304
Every structure of UniProt P06897
Every structure of UniProt P02281
Elsewhere: RCSB PDB 1KX4 · PDBe 1KX4 · UniProt P16105 · UniProt P02304 · UniProt P06897 · UniProt P02281

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.