Research workbench

X-ray structure of the nucleosome core particle, NCP146, at 2.0 a resolution

Analyse X-ray structure of the nucleosome core particle, NCP146, at 2.0 a resolution in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.

PDB: 1KX3
Type: protein + DNA
Length: 1,058 residues
Chains: 10
Method: x-ray diffraction
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAA…
UniProt: P84233, P62799, P06897, P02281
Ligands: MN
Pockets: 20 · best druggability 0.82

Structure

x-ray diffraction · 7 distinct chains · 62% helix, 6% strand (DSSP).

Chain	Molecule	Type	Residues	Secondary structure	UniProt
I, J	DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAA aaggcatgttcagctgaattcagctgaacatgccttttgatggagcagtttccaaatac ACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3')	dna	146	—	—
A, E	Histone H3	protein	98	65% helix, 4% strand	P84233
B	Histone H4	protein	82	61% helix, 9% strand	P62799
C	Histone H2A.1	protein	107	56% helix, 7% strand	P06897
D, H	Histone H2B.2	protein	94	74% helix, 4% strand	P02281
F	Histone H4	protein	87	57% helix, 8% strand	P62799
G	Histone H2A.1	protein	106	57% helix, 7% strand	P06897

Ligands and binding sites

MN · Manganese (II) ion · metal · 13 copies · chains I, J, E, F

Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.

Pockets

20 pockets found on a 1 Å grid, 20 with a druggability of 0.5 or more.

Pocket	Volume (Å³)	Druggability	Buriedness	Lining residues	Inside
1	1021	0.82	0.83	100	empty
2	423	0.76	0.85	55	empty
3	380	0.74	0.85	50	empty
4	744	0.67	0.75	43	empty
5	252	0.66	0.83	39	empty

Interfaces

38 interfaces between chains.

I–J · 6400 Å² buried · 518 hydrogen bonds · nucleic-nucleic
C–D · 2651 Å² buried · 25 hydrogen bonds · protein-protein
G–H · 2597 Å² buried · 24 hydrogen bonds · protein-protein
E–F · 2589 Å² buried · 25 hydrogen bonds · protein-protein
A–B · 2569 Å² buried · 27 hydrogen bonds · protein-protein

Compared structures

1KX3 · X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution · the same entry in another collection · chain H against H, TM-score 1.00
P84233 · AlphaFold monomer V2.0 prediction for histone H3.2 (P84233) · a predicted model of the same protein · chain A against A, TM-score 0.99
P06897 · AlphaFold monomer V2.0 prediction for histone H2A type 1 (P06897) · a predicted model of the same protein · chain G against A, TM-score 0.96

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Every structure of UniProt P84233
Every structure of UniProt P62799
Every structure of UniProt P06897
Every structure of UniProt P02281
Elsewhere: RCSB PDB 1KX3 · PDBe 1KX3 · UniProt P84233 · UniProt P62799 · UniProt P06897 · UniProt P02281

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.