Research workbench

Crystal structure of a topoisomerase II complex

Analyse Crystal structure of a topoisomerase II complex in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.

PDB: 5BTL
Type: protein + DNA
Length: 1,546 residues
Chains: 8
Method: x-ray diffraction
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: DNA gyrase subunit a; DNA gyrase subunit B; DNA substrate 24-mer…
EC: 5.99.1.3
UniProt: P9WG47, P9WG44
Ligands: 8MX, MG
Pockets: 13 · best druggability 0.85

Structure

x-ray diffraction · 5 distinct chains · 47% helix, 17% strand (DSSP).

Chain	Molecule	Type	Residues	Secondary structure	UniProt
A, C	DNA gyrase subunit a (EC 5.99.1.3)	protein	487	51% helix, 18% strand	P9WG47
B	DNA gyrase subunit B (EC 5.99.1.3)	protein	245	44% helix, 16% strand	P9WG44
D	DNA gyrase subunit B (EC 5.99.1.3)	protein	247	42% helix, 15% strand	P9WG44
E, H	DNA substrate 24-mer ggtcatgaatgactatgcacgtaa	dna	20	—	—
F, G	DNA substrate 24-mer ttacgtgcatagtcattcatgacc	dna	20	—	—

Ligands and binding sites

8MX · 1-cyclopropyl-6-fluoro-8-methyl-7-[(4as,7as)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4-oxo-1,4-dihydroquinoline-3-carboxylic acid · ligand · 2 copies · chains A, C, D, E, F, G, H, B
MG · Magnesium ion · metal · 4 copies · chains B, G, D, F, H, A, E, C

Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.

Pockets

13 pockets found on a 1 Å grid, 11 with a druggability of 0.5 or more.

Pocket	Volume (Å³)	Druggability	Buriedness	Lining residues	Inside
1	961	0.85	0.87	118	8MX, MG
2	477	0.78	0.86	62	empty
3	338	0.77	0.88	47	empty
4	1149	0.76	0.78	102	empty
5	584	0.75	0.82	60	empty

Interfaces

27 interfaces between chains.

E–G · 2431 Å² buried · 771 hydrogen bonds · nucleic-nucleic
F–H · 2375 Å² buried · 797 hydrogen bonds · nucleic-nucleic
A–C · 1834 Å² buried · 21 hydrogen bonds · protein-protein
C–D · 1628 Å² buried · 18 hydrogen bonds · protein-protein
A–B · 1621 Å² buried · 15 hydrogen bonds · protein-protein

Modifications

Observed in the structure: 2 modified (phosphorylation).

Compared structures

P9WG47 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit a (P9WG47) · a predicted model of the same protein · chain A against A, TM-score 0.97
P9WG44 · AlphaFold monomer V2.0 prediction for DNA gyrase subunit B (P9WG44) · a predicted model of the same protein · chain B against A, TM-score 0.91

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Every structure of UniProt P9WG47
Every structure of UniProt P9WG44
Elsewhere: RCSB PDB 5BTL · PDBe 5BTL · UniProt P9WG47 · UniProt P9WG44

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.