Research workbench
Structural basis of asymmetric DNA methylation and ATP-triggered long- range diffusion by ECOP15I
Analyse Structural basis of asymmetric DNA methylation and ATP-triggered long- range… in the GL1X research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides, crosslinks and neighbours on the 3D structure.
- PDB
- 4ZCF
- Type
- protein + DNA
- Length
- 1,895 residues
- Chains
- 5
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- Restriction endonuclease ECOP15I, modification subunit; Restriction endonuclease ECOP15I…
- UniProt
- Q5ZND1, Q5ZND2
- Ligands
- AMP, MN, CA
- Pockets
- 20 · best druggability 0.84
Structure
x-ray diffraction · 5 distinct chains · 39% helix, 19% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | Restriction endonuclease ECOP15I, modification subunit | protein | 616 | 38% helix, 21% strand | Q5ZND1 |
| B | Restriction endonuclease ECOP15I, modification subunit | protein | 612 | 36% helix, 19% strand | Q5ZND1 |
| C | Restriction endonuclease ECOP15I, restriction subunit | protein | 627 | 43% helix, 18% strand | Q5ZND2 |
| D | DNA 20-mer atacagcagtagactatgat | dna | 20 | — | — |
| E | DNA 20-mer aatcatagtctactgctgta | dna | 20 | — | — |
Ligands and binding sites
- AMP · Adenosine monophosphate · ligand · chains C
- MN · Manganese (II) ion · metal · 2 copies · chains A, C
- CA · Calcium ion · metal · chains B, D
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Pockets
20 pockets found on a 1 Å grid, 16 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 962 | 0.84 | 0.85 | 90 | AMP |
| 2 | 1192 | 0.83 | 0.84 | 109 | MN |
| 3 | 1028 | 0.78 | 0.80 | 99 | empty |
| 4 | 655 | 0.75 | 0.81 | 85 | empty |
| 5 | 860 | 0.73 | 0.77 | 86 | MN |
Interfaces
10 interfaces between chains.
- A–B · 4329 Ų buried · 60 hydrogen bonds · protein-protein
- A–C · 2453 Ų buried · 15 hydrogen bonds · protein-protein
- D–E · 926 Ų buried · 87 hydrogen bonds · nucleic-nucleic
- B–D · 721 Ų buried · 11 hydrogen bonds · protein-nucleic
- A–E · 667 Ų buried · 16 hydrogen bonds · protein-nucleic
Compared structures
- 4ZCF · Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by… · the same entry in another collection · chain A against A, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt Q5ZND1
- Every structure of UniProt Q5ZND2
- Elsewhere: RCSB PDB 4ZCF · PDBe 4ZCF · UniProt Q5ZND1 · UniProt Q5ZND2
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.