MolNFT v1 · #20218 · RNA

NMR structure of the R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), domain IV stem-loop B of enteroviral ires with aucccu bulge

1R7W · 34-mer: “NMR structure of the R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), domain IV stem-loop B of enteroviral ires with…”. Solution nmr. MolNFT v1 #20218 on GenesisL1: 3D structure, binding sites and pockets in GL1X.

PDB: 1R7W
Type: RNA
Length: 34 nucleotides
Chains: 1
Method: solution nmr
Collection: MolNFT v1 / PDB
Contract: 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
Owner: 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
Molecule: 34-mer

Structure

solution nmr · 1 distinct chain.

Chain	Molecule	Type	Residues	Secondary structure	UniProt
A	34-mer	rna	34	—	—

Compared structures

1R7W · NMR structure of the R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), domain IV stem-loop B of… · the same entry in another collection · chain A against A, TM-score 1.00

Analyse

Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
Elsewhere: RCSB PDB 1R7W · PDBe 1R7W

GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.