MolNFT v2 · #20224 · RNA
NMR structure of the R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), domain IV stem-loop B of enteroviral ires with aucccu bulge
MolNFT v2 record #20224 on GenesisL1: PDB 1R7W, “NMR structure of the R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), domain IV stem-loop B of enteroviral ires with aucccu bulge”. RNA, 34 nucleotides. 3D structure, sequence proof, BLAST…
- PDB
- 1R7W
- Type
- RNA
- Length
- 34 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v2 / PDB Bank
- Contract
- 0xd58B01f6C18086e5202cdC5D7Ad3E41790360102
- Owner
- 0xF4e1AA6f26B7DA48EeAD9B24a97927303eeA07b8
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.