MolNFT v1 · #17189 · DNA
NMR structure of 24-mer deoxyribonucleic acid, 7 structures
1OLD · DNA (gatcgaaacgtagcgccttcgatc): “NMR structure of 24-mer deoxyribonucleic acid, 7 structures”. Solution nmr, 1 ligand (AAR). MolNFT v1 #17189 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 1OLD
- Type
- DNA
- Length
- 24 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA (gatcgaaacgtagcgccttcgatc)
- Ligands
- AAR
Structure
solution nmr · 1 distinct chain.
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | DNA (gatcgaaacgtagcgccttcgatc) | dna | 24 | — | — |
Ligands and binding sites
- AAR · Arginineamide · ligand · chains A
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Compared structures
- 1OLD · NMR structure of 24-mer deoxyribonucleic acid, 7 structures · the same entry in another collection · chain A against A, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Elsewhere: RCSB PDB 1OLD · PDBe 1OLD
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.