MolNFT v1 · #12965 · protein + DNA
X-ray structure of the nucleosome core particle, NCP147, at 1.9 a resolution
1KX5 · DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCAT…: “X-ray structure of the nucleosome core particle, NCP147, at 1.9 a resolution”. X-ray diffraction, 2 ligands (MN, CL), 20 pockets (best druggability 0.81). MolNFT v1…
- PDB
- 1KX5
- Type
- protein + DNA
- Length
- 1,268 residues
- Chains
- 10
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAA…
- UniProt
- P16105, P02304, P06897, P02281
- Ligands
- MN, CL
- Pockets
- 20 · best druggability 0.81
Structure
x-ray diffraction · 6 distinct chains · 51% helix, 5% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| I | DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAA aaggcatgttcagctggaatccagctgaacatgccttttgatggagcagtttccaaata CACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') | dna | 147 | — | — |
| J | DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAA aaggcatgttcagctggattccagctgaacatgccttttgatggagcagtttccaaata CACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') | dna | 147 | — | — |
| A, E | Histone H3 | protein | 135 | 47% helix, 3% strand | P16105 |
| B, F | Histone H4 | protein | 102 | 49% helix, 7% strand | P02304 |
| C, G | Histone H2A.1 | protein | 128 | 49% helix, 5% strand | P06897 |
| D, H | Histone H2B.2 | protein | 122 | 57% helix, 3% strand | P02281 |
Ligands and binding sites
- MN · Manganese (II) ion · metal · 14 copies · chains I, J, E, F
- CL · Chloride ion · ion · 4 copies · chains A, J, C, D, E, G, H
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Pockets
20 pockets found on a 1 Å grid, 20 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 866 | 0.81 | 0.84 | 67 | empty |
| 2 | 540 | 0.76 | 0.83 | 56 | empty |
| 3 | 335 | 0.75 | 0.87 | 44 | empty |
| 4 | 813 | 0.70 | 0.77 | 72 | MN |
| 5 | 302 | 0.68 | 0.83 | 49 | empty |
Interfaces
37 interfaces between chains.
- I–J · 6534 Ų buried · 585 hydrogen bonds · nucleic-nucleic
- C–D · 2704 Ų buried · 22 hydrogen bonds · protein-protein
- E–F · 2694 Ų buried · 29 hydrogen bonds · protein-protein
- G–H · 2664 Ų buried · 26 hydrogen bonds · protein-protein
- A–B · 2554 Ų buried · 23 hydrogen bonds · protein-protein
Compared structures
- 1KX5 · X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution · the same entry in another collection · chain C against C, TM-score 1.00
- P06897 · AlphaFold monomer V2.0 prediction for histone H2A type 1 (P06897) · a predicted model of the same protein · chain C against A, TM-score 0.82
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P16105
- Every structure of UniProt P02304
- Every structure of UniProt P06897
- Every structure of UniProt P02281
- Elsewhere: RCSB PDB 1KX5 · PDBe 1KX5 · UniProt P16105 · UniProt P02304 · UniProt P06897 · UniProt P02281
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.