MolNFT v1 · #102926 · protein + DNA
Human MUS81-EME1-3'FLAP DNA complex
4P0S · Crossover junction endonuclease MUS81: “Human MUS81-EME1-3'FLAP DNA complex”. X-ray diffraction, 20 pockets (best druggability 0.82). MolNFT v1 #102926 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 4P0S
- Type
- protein + DNA
- Length
- 2,396 residues
- Chains
- 20
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- Crossover junction endonuclease MUS81; Crossover junction endonuclease EME1; DNA…
- EC
- 3.1.22.-
- UniProt
- Q96NY9, Q96AY2
- Pockets
- 20 · best druggability 0.82
Structure
x-ray diffraction · 5 distinct chains · 42% helix, 16% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A, C, E, G | Crossover junction endonuclease MUS81 (EC 3.1.22.-) | protein | 275 | 39% helix, 19% strand | Q96NY9 |
| B, D, F, H | Crossover junction endonuclease EME1 (EC 3.1.22.-) | protein | 284 | 45% helix, 13% strand | Q96AY2 |
| I, M, Q, U | DNA gaatgtgtgtct | dna | 12 | — | — |
| J, N, R, V | DNA tagacacacattcgggacatgcag | dna | 19 | — | — |
| L, P, T, X | DNA tctgcatgtcatt | dna | 9 | — | — |
Pockets
20 pockets found on a 1 Å grid, 20 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 1148 | 0.82 | 0.83 | 83 | empty |
| 2 | 1051 | 0.80 | 0.82 | 89 | empty |
| 3 | 919 | 0.80 | 0.82 | 70 | empty |
| 4 | 510 | 0.80 | 0.87 | 63 | empty |
| 5 | 378 | 0.79 | 0.88 | 61 | empty |
Interfaces
40 interfaces between chains.
- A–B · 3438 Ų buried · 42 hydrogen bonds · protein-protein
- C–D · 3277 Ų buried · 35 hydrogen bonds · protein-protein
- G–H · 3266 Ų buried · 31 hydrogen bonds · protein-protein
- E–F · 2608 Ų buried · 23 hydrogen bonds · protein-protein
- D–H · 568 Ų buried · 9 hydrogen bonds · protein-protein
Compared structures
- 4P0S · human Mus81-Eme1-3'flap DNA complex · the same entry in another collection · chain X against X, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt Q96NY9
- Every structure of UniProt Q96AY2
- Elsewhere: RCSB PDB 4P0S · PDBe 4P0S · UniProt Q96NY9 · UniProt Q96AY2
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.