MolNFT v1 · #102925 · protein + DNA
Human MUS81-EME1-3'FLAP DNA complex
4P0R · Crossover junction endonuclease MUS81: “Human MUS81-EME1-3'FLAP DNA complex”. X-ray diffraction, 20 pockets (best druggability 0.83). MolNFT v1 #102925 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 4P0R
- Type
- protein + DNA
- Length
- 1,208 residues
- Chains
- 10
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- Crossover junction endonuclease MUS81; Crossover junction endonuclease EME1; DNA…
- EC
- 3.1.22.-
- UniProt
- Q96NY9, Q96AY2
- Pockets
- 20 · best druggability 0.83
Structure
x-ray diffraction · 5 distinct chains · 40% helix, 17% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A, C | Crossover junction endonuclease MUS81 (EC 3.1.22.-) | protein | 275 | 35% helix, 21% strand | Q96NY9 |
| B, D | Crossover junction endonuclease EME1 (EC 3.1.22.-) | protein | 284 | 44% helix, 13% strand | Q96AY2 |
| E, H | DNA ctgtgtgtaagcacg | dna | 12 | — | — |
| F, I | DNA acgtgcttacacacagaggttagggtgaactt | dna | 23 | — | — |
| G, J | DNA caagttcaccctaacctcag | dna | 10 | — | — |
Pockets
20 pockets found on a 1 Å grid, 11 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 909 | 0.83 | 0.85 | 82 | empty |
| 2 | 1065 | 0.80 | 0.82 | 75 | empty |
| 3 | 498 | 0.76 | 0.85 | 63 | empty |
| 4 | 487 | 0.76 | 0.84 | 51 | empty |
| 5 | 502 | 0.75 | 0.83 | 49 | empty |
Interfaces
19 interfaces between chains.
- C–D · 3186 Ų buried · 43 hydrogen bonds · protein-protein
- A–B · 3167 Ų buried · 42 hydrogen bonds · protein-protein
- E–F · 504 Ų buried · 36 hydrogen bonds · nucleic-nucleic
- H–I · 500 Ų buried · 35 hydrogen bonds · nucleic-nucleic
- C–I · 490 Ų buried · 4 hydrogen bonds · protein-nucleic
Compared structures
- 4P0R · human Mus81-Eme1-3'flap DNA complex · the same entry in another collection · chain G against G, TM-score 1.00
- Q96NY9 · AlphaFold monomer V2.0 prediction for crossover junction endonuclease MUS81 (Q96NY9) · a predicted model of the same protein · chain A against A, TM-score 0.93
- Q96AY2 · AlphaFold monomer V2.0 prediction for crossover junction endonuclease EME1 (Q96AY2) · a predicted model of the same protein · chain B against A, TM-score 0.84
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt Q96NY9
- Every structure of UniProt Q96AY2
- Elsewhere: RCSB PDB 4P0R · PDBe 4P0R · UniProt Q96NY9 · UniProt Q96AY2
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.