MolNFT v1 · #22967 · RNA
Solution structure of tetraloop receptor RNA, NMR, 20 structures
1TLR · RNA tetraloop receptor (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3'): “Solution structure of tetraloop receptor RNA, NMR, 20 structures”. Solution nmr. MolNFT v1 #22967 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 1TLR
- Type
- RNA
- Length
- 23 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- RNA tetraloop receptor (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3')
Structure
solution nmr · 1 distinct chain.
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | RNA tetraloop receptor (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') | rna | 23 | — | — |
Compared structures
- 1TLR · Solution structure of tetraloop receptor RNA, NMR, 20 structures · the same entry in another collection · chain A against A, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Elsewhere: RCSB PDB 1TLR · PDBe 1TLR
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.