MolNFT v1 · #21452 · protein + DNA
Three-dimensional structure of S.AUREUS methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds- DNA
1SAX · 5'-D(GCTCCGATATTACAGTTGTAATTTT)-3': “Three-dimensional structure of S.AUREUS methicillin-resistance regulating transcriptional repressor meci in…”. X-ray diffraction, 1 ligand (K), 3 pockets (best druggability 0.73). MolNFT v1…
- PDB
- 1SAX
- Type
- protein + DNA
- Length
- 290 residues
- Chains
- 4
- Method
- x-ray diffraction
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- 5'-D(GCTCCGATATTACAGTTGTAATTTT)-3'; 5'-D(CAAAATTACAACTGTAATATCGGAG)-3'; Methicillin…
- UniProt
- P68262
- Ligands
- K
- Pockets
- 3 · best druggability 0.73
Structure
x-ray diffraction · 3 distinct chains · 62% helix, 11% strand (DSSP).
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| C | 5'-D(GCTCCGATATTACAGTTGTAATTTT)-3' | dna | 25 | — | — |
| D | 5'-D(CAAAATTACAACTGTAATATCGGAG)-3' | dna | 25 | — | — |
| A, B | Methicillin resistance regulatory protein meci | protein | 120 | 62% helix, 11% strand | P68262 |
Ligands and binding sites
- K · Potassium ion · metal · chains B
Binding sites are the residues within 4.5 Å of a ligand's heavy atoms.
Pockets
3 pockets found on a 1 Å grid, 2 with a druggability of 0.5 or more.
| Volume (ų) | Druggability | Buriedness | Lining residues | Inside | |
|---|---|---|---|---|---|
| 1 | 1063 | 0.73 | 0.77 | 88 | empty |
| 2 | 96 | 0.62 | 0.88 | 20 | empty |
| 3 | 110 | 0.39 | 0.76 | 14 | empty |
Interfaces
6 interfaces between chains.
- A–B · 2092 Ų buried · 27 hydrogen bonds · protein-protein
- C–D · 1070 Ų buried · 85 hydrogen bonds · nucleic-nucleic
- D–A · 544 Ų buried · 13 hydrogen bonds · protein-nucleic
- C–B · 470 Ų buried · 13 hydrogen bonds · protein-nucleic
- C–A · 358 Ų buried · 4 hydrogen bonds · protein-nucleic
Compared structures
- 1SAX · Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional… · the same entry in another collection · chain C against C, TM-score 1.00
- P68262 · AlphaFold monomer V2.0 prediction for methicillin resistance regulatory protein meci… · a predicted model of the same protein · chain A against A, TM-score 0.94
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Every structure of UniProt P68262
- Elsewhere: RCSB PDB 1SAX · PDBe 1SAX · UniProt P68262
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.