MolNFT v1 · #123009 · DNA
Diy G-quadruplexes: solution structure of D(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
5J6U · DNA (25-mer): “Diy G-quadruplexes: solution structure of D(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium”. Solution nmr. MolNFT v1 #123009 on GenesisL1: 3D structure, binding sites and pockets in GL1X.
- PDB
- 5J6U
- Type
- DNA
- Length
- 25 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v1 / PDB
- Contract
- 0xDE3723766Bc32dcACD03C17BaA400A7B36837Eba
- Owner
- 0x3396CDB397284571d12822B4ae1189a8E22AAAAA
- Molecule
- DNA (25-mer)
Structure
solution nmr · 1 distinct chain.
| Chain | Molecule | Type | Residues | Secondary structure | UniProt |
|---|---|---|---|---|---|
| A | DNA (25-mer) | dna | 25 | — | — |
Compared structures
- 5J6U · DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium · the same entry in another collection · chain A against A, TM-score 1.00
Analyse
- Open in the research workbench: secondary structure, accessibility, pockets, interfaces, conservation, variants, modifications, peptides and crosslinks on the 3D structure
- Elsewhere: RCSB PDB 5J6U · PDBe 5J6U
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.