MolNFT v2 · #44427 · DNA
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
MolNFT v2 record #44427 on GenesisL1: PDB 2M6W, “Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions”. DNA, 24 nucleotides. 3D structure, sequence proof, BLAST and structure search in GL1X.
- PDB
- 2M6W
- Type
- DNA
- Length
- 24 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v2 / PDB Bank
- Contract
- 0xd58B01f6C18086e5202cdC5D7Ad3E41790360102
- Owner
- 0xF4e1AA6f26B7DA48EeAD9B24a97927303eeA07b8
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.