MolNFT v2 · #19844 · RNA
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
MolNFT v2 record #19844 on GenesisL1: PDB 1QWB, “NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus…”. RNA, 26 nucleotides. 3D structure, sequence proof, BLAST and…
- PDB
- 1QWB
- Type
- RNA
- Length
- 26 nucleotides
- Chains
- 1
- Method
- solution nmr
- Collection
- MolNFT v2 / PDB Bank
- Contract
- 0xd58B01f6C18086e5202cdC5D7Ad3E41790360102
- Owner
- 0xF4e1AA6f26B7DA48EeAD9B24a97927303eeA07b8
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.