MolNFT v2 · #123128 · nucleotide
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
MolNFT v2 record #123128 on GenesisL1: PDB 5J05, “DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium”. Nucleotide, 20 nucleotides. 3D structure, sequence proof, BLAST and structure search in GL1X.
- PDB
- 5J05
- Type
- nucleotide
- Length
- 20 nucleotides
- Collection
- MolNFT v2 / PDB Bank
- Contract
- 0xd58B01f6C18086e5202cdC5D7Ad3E41790360102
- Owner
- 0xF4e1AA6f26B7DA48EeAD9B24a97927303eeA07b8
GL1X is a live explorer of the GenesisL1 blockchain. Turn on JavaScript for search, charts and interactive views.